cpg a Search Results


92
Hycult Biotech cpg a dna
Cpg A Dna, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg a dna/product/Hycult Biotech
Average 92 stars, based on 1 article reviews
cpg a dna - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

90
Hokkaido System Science Co full-sized cpg-a (2,216, sequence 50-gggggacgatcgtcgggggg-30)
Full Sized Cpg A (2,216, Sequence 50 Gggggacgatcgtcgggggg 30), supplied by Hokkaido System Science Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/full-sized cpg-a (2,216, sequence 50-gggggacgatcgtcgggggg-30)/product/Hokkaido System Science Co
Average 90 stars, based on 1 article reviews
full-sized cpg-a (2,216, sequence 50-gggggacgatcgtcgggggg-30) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Nihon Gene Research Laboratories cpg-a
Cpg A, supplied by Nihon Gene Research Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg-a/product/Nihon Gene Research Laboratories
Average 90 stars, based on 1 article reviews
cpg-a - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
TriLink cpg odn-2216 type a class
Cpg Odn 2216 Type A Class, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg odn-2216 type a class/product/TriLink
Average 90 stars, based on 1 article reviews
cpg odn-2216 type a class - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Coley Pharmaceutical immunostimulatory dna cpg-a 2336
Immunostimulatory Dna Cpg A 2336, supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/immunostimulatory dna cpg-a 2336/product/Coley Pharmaceutical
Average 90 stars, based on 1 article reviews
immunostimulatory dna cpg-a 2336 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Fasmac Co Ltd cpg-a (ggtgcatcgatgcagggggg) ( 40 )
Cpg A (Ggtgcatcgatgcagggggg) ( 40 ), supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg-a (ggtgcatcgatgcagggggg) ( 40 )/product/Fasmac Co Ltd
Average 90 stars, based on 1 article reviews
cpg-a (ggtgcatcgatgcagggggg) ( 40 ) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
TIB MOLBIOL cpg-a oligodeoxynucleotide 2216
Cpg A Oligodeoxynucleotide 2216, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg-a oligodeoxynucleotide 2216/product/TIB MOLBIOL
Average 90 stars, based on 1 article reviews
cpg-a oligodeoxynucleotide 2216 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Pfizer Inc cpg-a odn 6016
Cpg A Odn 6016, supplied by Pfizer Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg-a odn 6016/product/Pfizer Inc
Average 90 stars, based on 1 article reviews
cpg-a odn 6016 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Coley Pharmaceutical cpg a (odn 2663) (sequence: 5’ g*g*ggacgacgtcgtgg*g*g*g*g*g 3’)
Cpg A (Odn 2663) (Sequence: 5’ G*G*Ggacgacgtcgtgg*G*G*G*G*G 3’), supplied by Coley Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg a (odn 2663) (sequence: 5’ g*g*ggacgacgtcgtgg*g*g*g*g*g 3’)/product/Coley Pharmaceutical
Average 90 stars, based on 1 article reviews
cpg a (odn 2663) (sequence: 5’ g*g*ggacgacgtcgtgg*g*g*g*g*g 3’) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Hokkaido System Science Co biotinylated a3011 odn or cpg-a
Biotinylated A3011 Odn Or Cpg A, supplied by Hokkaido System Science Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotinylated a3011 odn or cpg-a/product/Hokkaido System Science Co
Average 90 stars, based on 1 article reviews
biotinylated a3011 odn or cpg-a - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Eurofins cpg-a odn 2216
Cpg A Odn 2216, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg-a odn 2216/product/Eurofins
Average 90 stars, based on 1 article reviews
cpg-a odn 2216 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Hokkaido System Science Co cpg-a 1585
Cpg A 1585, supplied by Hokkaido System Science Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpg-a 1585/product/Hokkaido System Science Co
Average 90 stars, based on 1 article reviews
cpg-a 1585 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results